rs11168758 chr12:48851847 A>G
- Sequence
gggggtatcagaggcgctgtgccc[A/G]taggcagagtcctgggaggaaaat
- ASB in cell types
- K562 (myelogenous leukemia) primary B-CLL cells
- ASB for transcription factors
- BRD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRD4_HUMAN | 2.21 | 0.72 | 1.33 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), body mass index (bmi), ldl cholesterol, serum creatinine, triglycerides change with statins
GTEx eQTL Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood