rs11169155 chr12:49778295 T>C
- Sequence
acttcatcttctcctggtgttccc[T/C]ttgccttcgcaggcagcaggttcc
- ASB in cell types
- foreskin keratinocyte adult erythroblasts CD34+ stem cells-derived erythroblasts
- ASB for transcription factors
- CTCF_HUMAN KDM6A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.66 | 0.53 | 1.25 | n/a | No Hit | |||
| KDM6A_HUMAN | 2.15 | -1.07 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Substantia_nigra, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic