rs11170711 chr12:53836459 C>G
- Sequence
tgtaataccaattcacttcctctc[C/G]cctagctgctggggatatgggtaa
- ASB in cell types
- T47D (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| T47D (invasive ductal carcinoma) | 0.67 | -0.17 | 1.39 |
Items per page:
1 – 1 of 1