rs11172881 chr12:59037663 C>A
- Sequence
acgcaccaccaccaccacaagcac[C/A]caaacaactgattaaacgatggaa
- ASB in cell types
- LHSAR (prostate epithelial cells) prostate cancer
- ASB for transcription factors
- HXB13_HUMAN ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HXB13_HUMAN | -2.94 | 3.10 | 1.00 | n/a | No Hit | |||
| ANDR_HUMAN | 0.44 | 2.43 | 3.00 | 2.72 | Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP college completion, height, infant head circumference, microalbuminuria, total cholesterol, years of education