rs11175307 chr12:64274069 G>A
- Sequence
ccatgcactgtttgtgcctctaat[G/A]agggaatctcccctgtcacggggg
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line) GM18526 (B – cells Lymphoblastoid Cell Lines) GM12891 (male B- cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19239 (male B-cells lymphoblastoid cell line) | 1.99 | -0.52 | 1.00 | |||
| GM18526 (B – cells Lymphoblastoid Cell Lines) | 2.75 | 0.25 | 1.00 | |||
| GM12891 (male B- cells lymphoblastoid cell line) | 1.57 | -0.29 | 1.00 |
Items per page:
1 – 3 of 3