rs11175799 chr12:65523722 T>C
- Sequence
ggaagtagatctggtttgaatcaa[T/C]ctggcctacacagacttgcttgac
- ASB in cell types
- SK-N-SH (neuroblastoma) HUVEC-C (HUVEC, umbilical vein endothelial cells)
- ASB for transcription factors
- GATA3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA3_HUMAN | 1.67 | -0.64 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, diastolic blood pressure (dbp), height, irritible bowel syndrome, major depressive disorder, salmonella-induced pyroptosis, systolic blood pressure (sbp), waist hip ratio
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial