rs11177206 chr12:68406372 C>T
- Sequence
tgtttcaacacggatagtcctccc[C/T]accccgcttcctctgctgtccccc
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HUVEC-C (HUVEC, umbilical vein endothelial cells) | 1.83 | -3.39 | 2.17 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP chronic kidney disease, diastolic blood pressure (dbp), fasting blood glucose, homa-b, neuroblastoma (brain cancer), systolic blood pressure (sbp)