rs11177613 chr12:69357652 T>C
- Sequence
taaatgcagcacatagactagcca[T/C]gtgagggcagcagagggccactac
- ASB in cell types
- adult erythroblasts MCF7 (Invasive ductal breast carcinoma) CD14+ monocytes gastroesophageal sphincter
- ASB for transcription factors
- KDM6A_HUMAN ZN444_HUMAN SP7_HUMAN STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| KDM6A_HUMAN | 2.38 | n/a | 2.00 | n/a | n/a | |||
| ZN444_HUMAN | -2.00 | 2.38 | 1.00 | n/a | No Hit | |||
| SP7_HUMAN | 2.67 | -4.89 | 2.00 | n/a | No Hit | |||
| STAT1_HUMAN | 1.41 | 0.68 | 1.67 | n/a | No Hit |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol, infant head circumference, parkinsons disease, triglycerides change with statins
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Breast_Mammary_Tissue, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood