rs11177793 chr12:69686002 G>A
- Sequence
gtttcactcacaggatgacattct[G/A]tctgttccgggctcatcatgtgag
- ASB in cell types
- LHSAR (prostate epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LHSAR (prostate epithelial cells) | 2.37 | n/a | 1.50 |
Items per page:
1 – 1 of 1