rs11178112 chr12:70154553 G>C
- Sequence
gtttcaaagctaaactataaacta[G/C]ttcctcccaaagttagttcagcct
- ASB in cell types
- MOLM14 (Adult acute myeloid leukemia)
- ASB for transcription factors
- CDK8_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CDK8_HUMAN | -0.15 | 1.80 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Anterior_cingulate_cortex_BA24, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Cells_Cultured_fibroblasts, Pituitary, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood