rs11178156 chr12:70241967 A>G
- Sequence
gaagaggaagggactatttgcaga[A/G]gacggggagaaagaaaggaaagac
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.07 | 0.84 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd
GTEx eQTL Artery_Tibial, Brain_Amygdala, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Hippocampus, Brain_Hypothalamus, Brain_Putamen_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Brain_Substantia_nigra, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Liver, Muscle_Skeletal, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood