rs11179922 chr12:74111751 T>C
- Sequence
atcttgatgcttgtggatatttgt[T/C]gatatccgggcattgtaaagttag
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19239 (male B-cells lymphoblastoid cell line) | 1.77 | -1.22 | 1.00 | |||
| foreskin keratinocyte | -2.83 | 1.35 | 2.50 |
Items per page:
1 – 2 of 2