rs11180166 chr12:74689200 T>C
- Sequence
tacaaaaagctttaattcacttga[T/C]ttttttggtggtggaattggcata
- ASB in cell types
- KMS-11 (Plasma cell myeloma) CD34+ stem cells-derived erythroblasts ID00015 (lymphoblastoid cell) HeLa (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| KMS-11 (Plasma cell myeloma) | 0.39 | 2.05 | 2.00 | |||
| CD34+ stem cells-derived erythroblasts | 2.48 | n/a | 2.00 | |||
| ID00015 (lymphoblastoid cell) | 2.17 | n/a | 1.00 | |||
| HeLa (cervical adenocarcinoma) | -0.24 | 1.35 | 2.00 |
Items per page:
1 – 4 of 4