rs11180823 chr12:76084161 A>C
- Sequence
tgagggaaaagcaggggggtgtcc[A/C]agaggcggccggctctgcactcgg
- ASB in cell types
- MDA-MB-231 (breast adenocarcinoma) neural cell HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MDA-MB-231 (breast adenocarcinoma) | 0.41 | 1.09 | 1.00 | |||
| neural cell | -0.43 | 1.48 | 1.00 | |||
| HEK293 (embryonic kidney) | 0.67 | 0.14 | 2.01 |
Items per page:
1 – 3 of 3