rs11181702 chr12:42820145 G>A
- Sequence
taattattctgaataacattttcc[G/A]ttttaaaccctcattttatggggt
- ASB in cell types
- 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | -0.77 | 2.21 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP antidepressant drug treatment outcome in depression, area adjusted bone mineral content, hypertension (early onset hypertension), irritible bowel syndrome, ldl cholesterol change with statins, total cholesterol, total cholesterol change with statins, waist hip ratio