rs11182852 chr12:45131055 T>C
- Sequence
tagggactgacttcttacataggg[T/C]tttaggactcttaaacatgcggtc
- ASB in cell types
- K562 (myelogenous leukemia) gastroesophageal sphincter MM1.S (plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.09 | 0.85 | 2.00 | |||
| gastroesophageal sphincter | 2.08 | 0.03 | 1.00 | |||
| MM1.S (plasma cell myeloma) | 1.73 | -1.11 | 1.17 |
Items per page:
1 – 3 of 3