rs11183479 chr12:46430381 T>C
- Sequence
agacatagaacttgtcattgtaaa[T/C]gcagtgtcagtaggtcaatgaccc
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells) MCF10A (breast epithelial cells)
- ASB for transcription factors
- TEAD4_HUMAN SUH_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TEAD4_HUMAN | -3.06 | 3.12 | 1.00 | n/a | No Hit | |||
| SUH_HUMAN | -2.78 | 1.84 | 1.50 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Left_Ventricle, Nerve_Tibial, Ovary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid, Whole_Blood