rs11185476 chr3:195851225 C>T
- Sequence
acggatcctacgtgacaaaatagt[C/T]ttgcgaacaattttaagacaaact
- ASB in cell types
- foreskin keratinocyte GM18486 (Lymphoblastoid Cell Lines) Kasumi-1 (acute myeloblastic leukemia) CD34+ stem cells-derived erythroblasts
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.61 | n/a | 2.33 | |||
| GM18486 (Lymphoblastoid Cell Lines) | -0.26 | 0.97 | 1.00 | |||
| Kasumi-1 (acute myeloblastic leukemia) | 2.23 | -0.35 | 2.00 | |||
| CD34+ stem cells-derived erythroblasts | 2.50 | -0.02 | 2.00 | |||
| GM19239 (male B-cells lymphoblastoid cell line) | -0.39 | 0.68 | 1.00 |
Items per page:
1 – 5 of 8
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood