rs11185603 chr7:50267214 C>G
- Sequence
gtttgatcttcagtcttccccttc[C/G]ctcaagagcagccattctggtagc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) K562 (myelogenous leukemia) MOLT-4 (Adult T acute lymphoblastic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.56 | 0.97 | 1.11 | |||
| K562 (myelogenous leukemia) | 0.81 | -0.15 | 1.99 | |||
| MOLT-4 (Adult T acute lymphoblastic leukemia) | 0.82 | 1.15 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, hdl cholesterol, hdl cholesterol change with statins, rheumatoid arthritis, total cholesterol