rs11185932 chr10:80535642 G>A
- Sequence
tcaacggtggccacttccctcgac[G/A]aaacagtcgacttcattgtgacag
- ASB in cell types
- K562 (myelogenous leukemia) PANC1 (pancreatic ductal adenocarcinoma) CD14+ monocytes
- ASB for transcription factors
- CTCF_HUMAN LMBL2_HUMAN STAT1_HUMAN SMCA4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 3.36 | 0.33 | 1.44 | n/a | No Hit | |||
| LMBL2_HUMAN | -2.48 | 2.73 | 1.00 | n/a | n/a | |||
| STAT1_HUMAN | 1.84 | -0.65 | 2.00 | n/a | No Hit | |||
| SMCA4_HUMAN | -1.35 | 1.73 | 1.00 | n/a | n/a |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP antidepressant efficacy in major depressive disorder improvement after 2 weeks of treatment, birth weight, fasting blood glucose, ldl cholesterol, maternal transmission distortion, rheumatoid arthritis, transmission distortion
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Mucosa, Liver, Lung, Minor_Salivary_Gland, Nerve_Tibial, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Whole_Blood