rs112997374 chr17:62476311 C>T
- Sequence
aaaaatgggatcatcggccaggcg[C/T]ggtggctcatgcctgtaatcacag
- ASB for transcription factors
- PAX2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PAX2_HUMAN | 1.67 | -1.11 | 1.00 | 2.02 | Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Artery_Aorta, Brain_Cerebellar_Hemisphere, Lung, Prostate, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid