rs113039135 chr4:40149892 A>G
- Sequence
gcctgggtgacagagcgagactcc[A/G]tctcaaaaagaaaaaaaaaaaaaa
- ASB in cell types
- H929 (plasma cell myeloma) GM18526 (B – cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| H929 (plasma cell myeloma) | n/a | 2.19 | 1.00 | |||
| GM18526 (B – cells Lymphoblastoid Cell Lines) | 1.03 | -0.45 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Esophagus_Muscularis, Heart_Atrial_Appendage, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid