rs113049760 chr3:75429761 G>A
- Sequence
ggctgcttctccacagctggcccc[G/A]tcctatgattcatagggcagcaga
- ASB in cell types
- HeLa S3 (cervical adenocarcinoma) GM18486 (Lymphoblastoid Cell Lines) HMEC (human mammary epithelial cells)
- ASB for transcription factors
- CTCF_HUMAN SMC1A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 3.18 | -0.28 | 1.93 | n/a | No Hit | |||
| SMC1A_HUMAN | 2.17 | n/a | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Uterus, Whole_Blood