rs113050569 chr1:184222848 C>G
- Sequence
ctgtttgctctttcctaattcaga[C/G]gctttctttttcttctttttaaaa
- ASB in cell types
- neutrophils from periferal blood adrenal gland
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neutrophils from periferal blood | 2.30 | 0.12 | 1.00 | |||
| adrenal gland | 0.89 | -0.89 | 1.00 |
Items per page:
1 – 2 of 2