rs113056932 chr21:30408845 C>A
- Sequence
ttggtgtctgccgacagaactctc[C/A]ctcaaggctgatgcttgtgcctgt
- ASB in cell types
- GM02610 (Lymphoblastoid Cell Lines) GM02630 (Fanconi anemi)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02610 (Lymphoblastoid Cell Lines) | -2.61 | 3.00 | 1.00 | |||
| GM02630 (Fanconi anemi) | 2.24 | -1.97 | 1.00 |
Items per page:
1 – 2 of 2