rs113100127 chr20:38790686 T>G
- Sequence
atgcaagacccgctgtttcgccct[T/G]tcttcttccttaagagtttattca
- ASB in cell types
- K562 (myelogenous leukemia) GM12890 (Lymphoblastoid Cell Lines) 697 (B acute lymphoblastic leukemia with t(1;19)(q23;p13.3) E2A-PBX1 (TCF3-PBX1))
- ASB for transcription factors
- ZNF24_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZNF24_HUMAN | 0.15 | 1.51 | 2.00 | n/a | No Hit | |||
| STAG1_HUMAN | -4.08 | 2.62 | 1.33 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Liver