rs113135078 chr11:72025607 G>C
- Sequence
tacagtgggagatcctgattagtg[G/C]gccccttgcttctcagaatctaca
- ASB in cell types
- neural cell
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neural cell | -0.51 | 1.40 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Spleen, Thyroid