rs113148189 chr20:57089883 C>A
- Sequence
aggggctgcccagcgccaggtgtc[C/A]ctgcctgtgtcctgacaaagttac
- ASB in cell types
- WA01 (H1, human embryonic stem cells) Delta47 (plasma cell myeloma)
- ASB for transcription factors
- RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RAD21_HUMAN | 0.02 | 2.05 | 1.12 | n/a | n/a |
Items per page:
1 – 1 of 1