rs113160052 chr2:231406125 C>T
- Sequence
ggtagaaggagtcccagcctggat[C/T]caccacagccgtgtaaaacctgca
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) GM12891 (male B- cells lymphoblastoid cell line) SK-N-SH (neuroblastoma)
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 1.14 | 0.64 | 1.37 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Cortex, Colon_Sigmoid, Colon_Transverse, Esophagus_Muscularis, Lung, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid