rs113189067 chr10:3068865 C>T
- Sequence
tcccggttcctcctgccgcagatg[C/T]gtggaaaggcccggatggcggatt
- ASB in cell types
- MOLT-4 (Adult T acute lymphoblastic leukemia) breast tumor
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MOLT-4 (Adult T acute lymphoblastic leukemia) | 0.09 | 1.26 | 1.00 | |||
| breast tumor | 2.13 | -1.40 | 2.00 |
Items per page:
1 – 2 of 2