rs113204618 chr7:107578930 G>A
- Sequence
caaaaattagctgggcgtggtggc[G/A]ggcgcctatagtcccagctactca
- ASB in cell types
- HT1080 (fibrosarcoma)
- ASB for transcription factors
- SSRP1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SSRP1_HUMAN | 2.26 | 1.17 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Anterior_cingulate_cortex_BA24, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Lung, Minor_Salivary_Gland, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood