rs113220820 chr7:35906643 T>C
- Sequence
gagttttgctgccacctagtggaa[T/C]gggatatcattgcttccatatcag
- ASB in cell types
- HeLa S3 (cervical adenocarcinoma) GM17942 (lymphoblastoid cell) HeLa (cervical adenocarcinoma) HCT-116-RAD21-mAC
- ASB for transcription factors
- CTCF_HUMAN RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.87 | 0.83 | 1.63 | 0.00 | Weak Discordant | |||
| RAD21_HUMAN | 1.15 | 0.29 | 1.80 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
