rs113229440 chr2:11907442 C>T
- Sequence
ggccgtgtagctggctttggccag[C/T]gggaagttagcaaacaggatgcaa
- ASB in cell types
- CD14+ monocytes macrophages form periferal blood
- ASB for transcription factors
- STAT1_HUMAN SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 2.37 | -1.02 | 2.00 | n/a | No Hit | |||
| SPI1_HUMAN | 2.86 | 0.77 | 2.00 | 0.45 | Weak Discordant |
Items per page:
1 – 2 of 2
Motif analysis
