rs113269948 chr13:27620834 C>T
- Sequence
gcggaagccccgctggctaggtgt[C/T]tgcgcgcacccccggccgccgcca
- ASB in cell types
- monocytes from periferal blood primary B-CLL cells
- ASB for transcription factors
- SRBP2_HUMAN BRD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SRBP2_HUMAN | 2.69 | n/a | 2.50 | n/a | No Hit | |||
| BRD4_HUMAN | 2.03 | n/a | 3.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Testis