rs113307173 chr20:62925739 G>C
- Sequence
gagcacccctcccgccgagcgcaa[G/C]agcgggccctttcggcttccgggg
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | -1.25 | 1.58 | 1.17 | 0.20 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
