rs113321242 chr6:37697691 C>G
- Sequence
ccgccgtctggccgcggccgtagc[C/G]ctcccgggctccgagctctcggga
- ASB in cell types
- Hep 3B2.1-7 (HEP-3B, Hepatocellular carcinoma)
- ASB for transcription factors
- EZH2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EZH2_HUMAN | -0.26 | 1.78 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Liver, Muscle_Skeletal, Thyroid, Whole_Blood