rs113353843 chr8:109974699 G>C
- Sequence
gacacagtccctgtgcacactgcc[G/C]gtcgccctggcccttcccaaacgt
- ASB in cell types
- GM19238 (female B-cells lymphoblastoid cell lines) GM02610 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.72 | 1.92 | 1.30 | -3.97 | Discordant |
Items per page:
1 – 1 of 1
Motif analysis
