rs113368091 chr12:51590852 C>A
- Sequence
agtggaggcgggcccggggacgct[C/A]gctggcgctcccgcgcggcgcccc
- ASB in cell types
- SEM (childhood B acute lymphoblastic leukemia) HEK293 (embryonic kidney) prostate gland
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| SEM (childhood B acute lymphoblastic leukemia) | 3.92 | n/a | 1.00 | |||
| HEK293 (embryonic kidney) | 0.32 | 1.30 | 1.95 | |||
| prostate gland | -1.29 | 1.56 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Nerve_Tibial, Testis, Thyroid