rs113375160 chr22:22848371 C>T
- Sequence
aagcacttcaacctgagactcagt[C/T]acaagaactgcacctgccccacct
- ASB in cell types
- 2588 (Lymphoblastoid Cell Lines) OCI-LY7 (diffuse large B-cell lymphoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 2588 (Lymphoblastoid Cell Lines) | 1.31 | -2.53 | 1.50 | |||
| OCI-LY7 (diffuse large B-cell lymphoma) | -0.62 | 1.68 | 1.11 |
Items per page:
1 – 2 of 2