rs113390889 chr19:11197621 C>T
- Sequence
tccggctggtcccgcccccccagc[C/T]ggcaccgccccctccagccgcccg
- ASB in cell types
- COLO-320 (colon adenocarcinoma)
- ASB for transcription factors
- TFAP4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TFAP4_HUMAN | -2.69 | 2.77 | 1.00 | 4.71 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Brain_Cortex, Heart_Left_Ventricle, Lung, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood