rs113401342 chr21:45555626 T>C
- Sequence
aggccaacccaccgtcccgggcac[T/C]tgggactcaggagggcggggcggg
- ASB for transcription factors
- EP400_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EP400_HUMAN | 3.25 | n/a | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Nerve_Tibial, Pancreas, Pituitary, Whole_Blood