rs113464444 chr12:121278627 G>C
- Sequence
gttttatcagggggttccgctttt[G/C]catcttcctcattctcgctgcctg
- ASB in cell types
- MDM(monocyte derived macrophages) macrophages form periferal blood CD14+ monocytes monocyte-derived macrophages from peripheral blood
- ASB for transcription factors
- SPI1_HUMAN STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 2.88 | n/a | 2.36 | 0.04 | Weak Discordant | |||
| STAT1_HUMAN | 2.40 | -0.45 | 3.00 | 2.43 | Discordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Heart_Atrial_Appendage, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Thyroid, Whole_Blood