rs113469256 chr9:19036814 A>G
- Sequence
ggggcaccacctagtggagctgtg[A/G]gaagagggccagcatcctccagac
- ASB in cell types
- 2588 (Lymphoblastoid Cell Lines) GM12890 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 2588 (Lymphoblastoid Cell Lines) | 1.40 | -0.58 | 1.00 | |||
| GM12890 (Lymphoblastoid Cell Lines) | 2.13 | -1.59 | 1.00 |
Items per page:
1 – 2 of 2