rs113474581 chr8:32548988 G>C
- Sequence
gtcgcgcggtgcttcccctcctgg[G/C]ggccgccgctcacctgggcgccga
- ASB in cell types
- A549 (lung carcinoma) GM17942 (lymphoblastoid cell) GM12892 (female B-cells lymphoblastoid cell line) glioblastoma cells
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 0.74 | 0.04 | 2.00 | |||
| GM17942 (lymphoblastoid cell) | -1.76 | 2.16 | 1.00 | |||
| GM12892 (female B-cells lymphoblastoid cell line) | 1.26 | -0.42 | 1.00 | |||
| glioblastoma cells | -0.24 | 1.72 | 1.50 | |||
| ID00014 (lymphoblastoid cell, DiGeorge syndrome) | 0.04 | 2.00 | 1.00 |
Items per page:
1 – 5 of 5