rs113484129 chr11:1865545 C>T
- Sequence
gtcgcctgctcacaccgtcccacc[C/T]gcaccgccggctgcactgtcaccc
- ASB in cell types
- SU-DHL-2 (anaplastic large cell lymphoma)
- ASB for transcription factors
- ITF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ITF2_HUMAN | 3.62 | n/a | 2.00 | 4.98 | Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Cells_Cultured_fibroblasts, Skin_Not_Sun_Exposed_Suprapubic, Testis, Thyroid