rs113500508 chr4:98995440 G>A
- Sequence
cgcccgaaggcgccgaatgggggg[G/A]ccctgccgagctcccttacagccc
- ASB in cell types
- GM02255 (Lymphoblastoid Cell Lines) GM02630 (Fanconi anemi) 2588 (Lymphoblastoid Cell Lines) GM19099 (female B-cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- STAG1_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 1.23 | -0.19 | 1.00 | n/a | n/a | |||
| CTCF_HUMAN | 0.65 | -0.26 | 1.00 | -0.80 | Weak Concordant |
Items per page:
1 – 2 of 2
Motif analysis
