rs113525534 chr4:39976739 G>A
- Sequence
ccagaggccggggacccggcagcg[G/A]cctcgccacccgctctttcccagg
- ASB in cell types
- HCT-116 (colon carcinoma) primary B-CLL cells
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HCT-116 (colon carcinoma) | 0.93 | 0.18 | 1.16 | |||
| primary B-CLL cells | 2.26 | n/a | 2.00 |
Items per page:
1 – 2 of 2