rs113540415 chr10:48306708 C>G
- Sequence
agccgagcggccgaggccggacga[C/G]gcggcttggattgcggagccgcga
- ASB in cell types
- breast tumor fetal bone marrow-derived mononuclear cells
- ASB for transcription factors
- ESR1_HUMAN KMT2A_HUMAN COT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 3.09 | n/a | 2.00 | n/a | No Hit | |||
| KMT2A_HUMAN | 2.95 | n/a | 2.00 | 0.72 | Weak Discordant | |||
| COT1_HUMAN | 2.33 | -1.93 | 1.00 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Cortex, Brain_Nucleus_accumbens_basal_ganglia, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood