rs113540688 chr7:44019181 G>A
- Sequence
ccgccaccagagccctaataagag[G/A]cctcttccggattactccggcggg
- ASB in cell types
- GM19099 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19099 (female B-cells Lymphoblastoid Cell Lines) | 0.92 | -2.12 | 1.33 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Skin_Not_Sun_Exposed_Suprapubic, Thyroid, Whole_Blood