rs113562536 chr10:71889059 C>A
- Sequence
aagcgcggggttgagggcgcagac[C/A]ggggcagaggagaggcgcgcaggt
- ASB in cell types
- LNCaP (prostate carcinoma) SUM159PT (Triple negative breast cancer)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP (prostate carcinoma) | 1.61 | -0.28 | 1.21 | |||
| SUM159PT (Triple negative breast cancer) | 1.30 | 0.68 | 1.18 |
Items per page:
1 – 2 of 2